Les Églises Chrétiennes de Dieu

[212A]

 

 

 

Les Fils de Sem : Partie I [212A]

 

(Édition 1.1 20060224-20060225-20070416)

 

 

 

Le droit d'aînesse a été transmis à Sem, le plus jeune fils de Noé, en tant que sacrificateur de Dieu dans l'ordre de Melchisédek. Les descendants de Sem ont effectué le sacerdoce jusqu'à Abraham et par la suite dans les lignées de la descendance d'Abraham. Sem a produit un certain nombre d'enfants et d'eux sortirent un certain nombre de pays importants du monde. Les fils de Sem se sont mêlés avec les fils de Cham et Japhet et les promesses de Dieu pour le monde seraient accomplies dans ce mélange des nations.

 

 

 

    

Christian Churches of God

PO Box 369, WODEN ACT 2606, AUSTRALIA

 

Courriel : secretary@ccg.org

 

 

(Copyright © 2007 Wade Cox)

(Tr. 2012)

 

Cette étude peut être copiée et distribuée librement à la condition qu'elle le soit en son entier, sans modifications ni rayures. On doit y inclure le nom, l'adresse de l’éditeur et l'avis des droits d'auteur. Aucun montant ne peut être exigé des récipiendaires des copies distribuées. De brèves citations peuvent être insérées dans des articles et des revues critiques sans contrevenir aux droits d'auteur.

 

Cette étude est disponible sur les pages du World Wide Web :
 http://www.logon.org/french/ et http://www.ccg.org/french/

 

    

Les Fils de Sem : Partie I [212A]

 

Préface

La Conversion des Fils d'Abraham

 

Dieu a établi une alliance avec Abraham et a dit qu'Il ferait de lui le père de nombreuses nations. À travers sa progéniture, que nous appelons les Patriarches, un certain nombre de nations ont débuté et elles ont reçu les promesses du droit d'aînesse et ont été faites l’élément d'une alliance permanente entre Dieu et Abraham qu'elles devaient poursuivre et réaliser.

 

Dans cette série nous allons traiter avec les identités et le destin ultime de ces nations et leur influence sur le reste du monde.

 

Au cours du prochain cycle de temps de 19 ans et la séquence finale des Guerres de la Fin arrivant au Jubilé de 2027, nous allons voir ces nations amenées à la repentance et à la conversion sur une base systématique et progressive.

 

La Partie I (No. 212A) porte sur les Fils de Sem et de leurs emplacements.

 

La Partie II (No. 212B) porte sur les fils de Lot, ainsi que ceux d'Ésaü et de leur identité, destin et conversion.

 

La Partie III (No. 212C) porte sur Ismaël et de son destin, sa conversion et sa place dans le Royaume de Dieu.

 

La Partie IV (No. 212D) porte sur les fils de Ketura et de leur identité, destin et conversion.

 

La Partie V (No. 212E) portera sur le destin de Juda et de sa conversion dans les Derniers Jours.

 

La Partie VI (No. 212F) portera sur Israël et sa crise et repentir.

 

La Partie VII (No. 212G) sera une Annexe pour les tableaux et graphiques

 

Ces six parties expliqueront ce qui est requis des fils d'Abraham et leur place dans la restauration du monde aux Lois de Dieu.

 

Les détails de l'alliance que Dieu a faite avec Abraham, l'héritage et le sacerdoce établi avec lui par Sem sont également expliqués sur le site www.abrahams-legacy.org

 

Introduction

 

Le but de cette étude est de développer l’ouvrage sur L’Origine Génétique des Nations (No. 265) et de traiter avec les fils de Sem, puis se diriger vers les fils d’Arpacschad et les descendants d'Abraham, et leur place dans l'histoire et la prophétie et leurs identités actuelles.

 

Les fils de Sem sont Elam et Assur, Arpacschad, Lud et Aram.

 

Nous savons avec certitude que les Élamites sont devenus les Perses, les fils d'Assur sont devenus les Assyriens, les fils d’Arpacschad sont devenus les Hébreux, et Aram est devenu les Syriens et la source du nom de la langue araméenne. Ils sont également allés plus tard, vers le nord en Arménie.

 

De l'échantillonnage de l'ADN moderne du projet assyrien, les Assyriens modernes sont L, G, J et certains R1b1, mais il semble que les R1b1 testés sont anglais du côté paternel et assyriens du côté maternel. Ainsi, le Nord d’Aram (dans le domaine de l'Arménie et la Géorgie) et Assur ont développé l’Haplogroupe G, qui est l'endroit où il se trouve dans les plus grands pourcentages.

 

Josephus nous donne une indication claire des fils d'Aram, quand il dit que sur les quatre fils d'Aram, Uts a fondé Trachonite et Damas, qui est le pays entre la Palestine et Ceolesyria, Hul a fondé l’Arménie et Guéter les Bactriens, et Masch les Mesaneans maintenant appelé Charax Spasini. À partir de ce dossier, l'Haplogroupe G sémite semble venir d'Aram et Assur. Josephus enregistre que Abraham s’est d'abord établi avec une armée à Damas (ibid., Whiston tr., p. 32).

 

Josephus dit que Jokthan des Hébreux avait treize fils : Elmodad, Saleph, Asermoth, Jera, Adoram, Aizel, Decla, Ébal, Abimael, Sabeus, Ophir, Eulat, et Jobab. Il dit que ces personnes vivaient en Asie de la Rivière indienne, Cophen, et les terres qui l'entourent. C'est Kaboul moderne et dans la vallée de sa rivière. Le terrain le plus vers l'Indus est la Bactriane. Ainsi, si cela est le fait de la question, il semble qu’ils se soient déplacés à travers la péninsule arabique et la plupart sont allés en Inde. Le résultat pourrait être des groupes composites de Jokthan dans ce qui est l'Afghanistan, Guéter à la Bactriane, puis Lud dans le Pendjab. L’Haplogroupe sémitique H en Inde serait alors dérivé d'une mutation qui s'est produite chez les Hébreux de Jokthan et les Sémites de Lud. Le coin d'or d'Ophir se réfère aux terres de l'un des fils de Jokthan qui s’est installé en Afghanistan ou en Inde, et donc la zone d'Ophir peut être de l'Hindu Kush en Inde ou peut-être, encore plus probable, au Sri Lanka (Ceylan) (voir aussi ci-dessous).

 

Afghans et autres Pashtounes

 

L’article de Wikipédia sur les Pachtounes dit qu'ils semblent être principalement d'origine iranienne, mais présentent des similitudes avec les Perses, les Kurdes, les Tadjiks et les Baloutches.

 

Les Pachtounes (ou Pukhtuns, selon le dialecte) de langue Pachtou se trouvent dans le sud et l'est de l'Afghanistan et l'ouest du Pakistan. Ces Pachtounes sont également devenus mêlés avec d'autres groupes, tels que les Ghilzay (qui se sont possiblement mêlés à des tribus turques), les Durrani (qui ont interagi avec les Tadjiks), et les tribus pachtounes au nord de Peshawar (qui se sont mêlées à des groupes Dardic).

 

L'article poursuit en disant que du premier au cinquième siècle AEC (avant notre ère) d’énormes migrations de populations d’Aryens, de Perses, de Sakas, de Scythes, de Kouchans, de Huns, et de Grecs se sont installées dans les régions où les Pachtounes vivaient. Les envahisseurs ultérieurs ont été les Arabes musulmans, les tribus turques d'Asie centrale et les Mongoles.

 

La preuve anthropologique que les Pachtounes de langue pachtou sont un peuple indo-européen caucasoïde, qui est lié à d'autres groupes iraniens et aux locuteurs des langues kalasha et Nuristanis, est loin d'être concluante. Jusqu'à présent, le test n'a pas montré de lien substantiel entre la population pachtoune échantillonnée pour les marqueurs génétiques qui se trouvent chez la plupart des Grecs, des Juifs, ou des Arabes. La réponse peut être que les Pachtounes ont été légèrement modifiés au fil du temps par divers envahisseurs et mélanges comme mentionné ci-dessus. Pourtant, ils ont gardé leur base génétiquement globale Est-iranienne.

 

Il y aurait donc aussi des ADN-Y R1a et R1b japhetiques et C chamitiques présents.

 

Plusieurs conclusions concernant les Sémites viennent de la prémisse que les Haplogroupes sémitiques sont tous J, tels que trouvés parmi les trois populations mentionnées.

 

Les Pachtounes sont considérés comme iraniens, qui, comme nous l'avons vu sont principalement de l’Haplogroupe I, qui est dérivé de l’Haplogroupe sémitique IJ (voir ci-dessous), mais ils varient en un regroupement d’ADN-Y composite typique de l’Asie centrale. Une tentative a été faite pour classer les Pachtounes au 16ème siècle comme l'un des Bani Israël, des Dix Tribus Perdues et comme Joseph. Cela a été démystifié basé sur leurs affinités indo-iraniennes et leur langue. Cependant, c’est un fait historique que la zone de Kandahar, Kaboul et la Bactriane aussi, de l'autre côté de l’Hindu Cush, ont été faites des provinces ou satrapies de l'Empire perse et leurs langues sont donc affectées par ce fait. Les similitudes de l'ADN avec Elam et leur rapport historique de descendance et d’affinité avec Jokthan indiquent que l'ADN original des Sémites, y compris les Hébreux Jokthan, n'était pas J, mais F et le dérivé primaire sémitique est I et les dérivés secondaires sont J, tous deux dérivés de IJ (basé sur S2 et S22) et ensuite H et G. Tous les Sémites de l'Est de l'Elam et Jokthan étaient Hg. I, plutôt que J. Ainsi, ces mutations ont eu lieu au cours du second millénaire AEC (avant l’ère courante) et les modèles mathématiques étendus des évolutionnistes sont faux.

 

Les tribus Durrany et Galzay sont tenues pour être les descendants directs des Ibrani ou Hébreux, et probablement des fils de Jokthan. Certains soutiennent également que les Rabbani, Shinwari, Levani, Deftali, et Jaji de l'Afghanistan, et les Efridi et Yusufzai en provenance du Pakistan sont aussi des tribus hébraïques.

 

Lud

 

Lud est une source d'incertitude et il y a deux explications pour l'identification des, et les emplacements des fils de Lud. Nous reviendrons sur ce casse-tête sous peu.

 

Autres Emplacements des Hébreux

 

L'origine et l'emplacement des Hébreux sont identifiés avec Abraham comme venant d'Ur de Chaldée et les fils d’Arpacschad sont identifiés avec les groupes akkadiens dans la plaine mésopotamienne entre les enfants d'Assur, ou les Assyriens, et les fils d'Elam, qui étaient à l'Est du bassin du Tigre sur le plateau persan.

 

L'autre groupe des Mèdes, qui ont été associés avec les Perses et ont occupé le haut pays, au nord de l'Elam et Gutea, ne sont pas fondamentalement sémites, mais nous allons voir qu'ils contiennent des Sémites maintenant de leur exposition aux Arabes et peut-être plus tôt. Les Kurdes sont principalement dérivé des Mèdes, les fils de Madai, un Japhethite. Nous allons y revenir plus tard. Les Guteans ou Guti pourraient bien aussi être associés avec les Goths comme éléments de la Horde parthe ou scythe ultérieure. Nous allons examiner leurs mouvements dans une étude ultérieure.

 

Le Professeur Cyrus Gordon soutient également que les Minoens primitifs sont des Sémites et leur langage Linéaire A comme étant sémitique. Son ouvrage sur Linéaire A a été reçu avec controverse.

 

Les fils d’Arpacschad sont les suivants : Schélach et Héber (d'où le nom Hébreu est dérivé). Ses fils Péleg et Jokthan ont vu la division dans les Hébreux. Les fils de Jokthan étaient au nombre de treize et ont occupé toute la zone orientale de la péninsule arabique (Genèse 10:21-32), mais beaucoup sont allés en Afghanistan ou au Pakistan, comme nous le voyons ci-dessus. Les fils d'Abraham à travers Agar et quelques-uns des fils de Ketura, comme Madian, se joignirent à eux plus tard. La ligne d'Abraham par Péleg était de Rehu, Serug, Nachor, Térach à Abraham, Nachor et Charan. Abraham a été appelé d'Ur en Chaldée et envoyé dans le pays de Canaan.

 

Il s'ensuit que les lignées des pays sémitiques nous donneront des indices quant à la distribution des Haplogroupes et des mutations sémites. La position de départ était de dire simplement que l'Haplogroupe J est l’Haplogroupe sémite et tous les autres ne sont pas sémites, mais cela ne peut pas être vrai étant donné la distribution et les mélanges des groupes de nations, et nous savons maintenant que cela est faux en ce qui concerne le proto Haplogroupe IJ. De la reconstitution historique, un certain nombre d'autres groupes sont également sémitiques, comme nous le verrons.

 

Par exemple, dans la structure génétique des Perses ou Élamites, Hg I est prédominant. Il dépasse J d'environ 10%, et a un élément de F et G avec elle. Ces groupes constituent la moitié de l’ADN-Y des Perses. Les Arabes du Moyen-Orient ont également une quantité importante de I et certains G. Les Haplogroupes G, I et J représentent la moitié des Géorgiens/Arméniens et des Turcs et F, G, I et J sont à moitié les Italiens avec I et J comprenant la moitié de l’ADN-Y des Grecs. Quand nous allons en Europe, l'équilibre de I augmente de façon spectaculaire.

 

G, (M201), H (M69), I (M170, M258, et P19) et J (12f2.1) semblent être des lignées sémitiques connues avec K (M9), la base de la racine de tous les fils de Japhet. Hg. J diminue à mesure qu’il se déplace à l'ouest en Europe, mais Hg. I reste plus ou moins généreusement important à l'ouest jusqu'aux Anglo-Saxons, puis diminue parmi les Basques, les Gallois, les Irlandais et les Écossais, mais il est néanmoins toujours présent dans des quantités allant jusqu'à 15% parmi ces Celtes connus.

 

Les Anglo-Saxons sont venus du Moyen-Orient comme élément de la horde à la chute de l'Empire parthe de ce qui est maintenant la région de l'Irak et la région au nord de celui-ci. Cela s'est produit à la fin du deuxième siècle EC (ère courante). Ils se sont déplacés dans la zone du Nord-ouest de l'Europe et la horde s’est scindée en plusieurs vagues. Les Anglo-Saxons et les Jutes et les tribus associées des Lombards, des Danois, des Norvégiens, des Saxons et des Fris, se sont divisés, mais ont conservé une diversité similaire. Les Français du Nord sont également du Moyen-Orient. Les Normands constituent un élément et sont principalement R1b mais ils contiennent d'autres groupes d'ADN tels que I. Les autres sont des Francs en deux groupes. Ce sont les Francs Riphatiens et les Francs Saliens. Les Francs Saliens pouvaient hériter à travers la lignée masculine seulement, mais les Francs Riphatiens pouvaient hériter à travers les deux lignées.

 

Comme nous le savons, Riphat était un fils de Japhet, et nous savons que la noblesse de ces personnes a également réclamé être descendante de Antenor I, Roi des Cimmériens, et aussi des Troyens. Ils ont été interprétés comme la progéniture du groupe qui est resté au Moyen-Orient avec les fils d'Hector. Ils ont nommé leur grande ville d’après Paris et Troyes. Beaucoup de ces personnes se sont installées à travers la Manche en Grande-Bretagne et les tribus (par exemple Parisii) étaient également des Celtes R1b. Plus de 35% de la partie nord française sont des Haplogroupes I et J. Environ 35% des Anglo-Saxons sont Hg. I du Moyen-Orient avec une petite quantité de J. Environ 40% des anglais sont du Moyen-Orient et apparemment Sémites de I muté du groupe IJ. La majorité de tous les Celtes du Nord-Ouest et des Anglo-Saxons sont R1b et une partie des mêmes divisions génétiques que les tribus japhethites connues. L'exception évidente est à l'Est, où les Slaves sont R1a, et les divisions plus grandes R1a parmi la horde à venir dans le Nord-Ouest ont été parmi les Norvégiens, à environ 30%.

 

Les Arabes

 

De la Bible, de la Torah et du Qour’an [Coran], nous apprenons que les Arabes sont les descendants de Sem, fils de Noé. Certains Arabes prétendent retracer leur ascendance directement à Noé et Adam.

 

L’origine arabe est divisée en deux grands groupes :

al-'Ariba qui signifie, "Pure Origine" et al-Musta'ribah qui signifie, les "Arabes arabisés".

 

Les Arabes Purs sont considérés comme des descendants de Noé à travers son fils Sem, à travers ses fils Aram et Arpacschad, et sont connus comme Qahtanites. Les Qahtanites sont considérés comme ayant pour origine les Arabes du Sud, selon les généalogies arabes.

 

Le terme Arabes arabisés peut être utilisé pour trois groupes différents :

1)      Pour les Arabes considérés comme des descendants d'Abraham par Ismaël, à travers son fils Adnan et connus sous le nom Adanites.

2)      Pour les Arabes, qui parlaient d'autres langues afro-asiatiques. Comme locuteurs arabes, ils sont considérés comme des Arabes à l'époque contemporaine.

3)      Pour les "Arabes mixtes", entre les "Arabes Purs" et les Arabes de l'Arabie du Sud.

 

L'éclatement de ces groupes sera discuté dans les études sur Ismaël et Ketura. 

Les Religions

 

Alors que la plupart des Arabes sont Musulmans, une minorité sont des Chrétiens, et certains sont Juifs. Les Musulmans sont composés des Sunnites, Chiites, Ibadites, Alaouites, Druzes ou Ismaili.

 

Avant l'introduction de l'Islam, la plupart des Arabes adoraient un certain nombre de divinités tandis que certains se sont convertis au Christianisme ou au Judaïsme. Les divinités païennes étaient celles comme Hubal, Wadd, Al-Lat, Manat et Uzza. Quelques hanifs ont favorisé une vague forme de monothéisme. Cependant, comme l'Islam s’étendait de plus en plus, les Arabes sont devenus Musulmans et les vieilles traditions ont disparu.

 

Les Chrétiens arabes suivent généralement l'une des quatre églises principales : copte, maronite, grecque-orthodoxe, ou gréco-catholique.

Les Gitans ou Roms

 

Lorsque l'explorateur britannique Richard Burton voyagea à travers le Pays de Madian à la fin du 19ème siècle, il a rencontré un peuple connu sous le nom de Hutaym (qui signifie brisé). Bien que Musulmans, ils étaient une tribu de parias également trouvés en Égypte.

           

    Les Arabes de Madian ont toujours comparé les Hutaym avec les Ghagar (Ghajar) ou Gitans d'Égypte, et c'est le point qui donne aux parias un intérêt passager. Je n'ai pas encore eu l'occasion d'étudier soigneusement la race ; je ne peux pas dire si elle montre des traces de compétence dans le travail des métaux. Pendant ce temps, nous devons nous demander si ces Ilotes [esclaves], maintenant ainsi dispersés, ne sont pas les immigrés anciens d'origine indienne, qui ont perdu leur langue aryenne, comme les Ghajar égyptiens. Dans ce cas, ils représentent les descendants des tribus nomades qui ont fait fonctionner les plus anciens ateliers. Peut-être qu'ils pourraient se révéler congénères des hommes de l'Âge du Bronze, et des premières vagues d’immigration gitane en Europe. (Burton, Midian (Revisited), p. 119 ; emphase ajoutée)

 

Burton poursuit en disant :

    Et je voudrais ici mettre l'accent particulier sur mon soupçon que les ancêtres des méprisés Hutaym peuvent avoir été la caste tsigane qui a travaillé les métaux, en Madian (ibid., p. 135).

 

Les Hutayim qu’il vit peuvent avoir été tout simplement le reste des vrais fils de Madian dont les tribus fraternelles avaient depuis longtemps migré vers d'autres régions du Moyen-Orient et éventuellement en Europe, certains peut-être via l'Inde.

 

Dans son livre Travels in Arabia (1845 et 1848) (réédité par The Oleander Press, Cambridge, Royaume-Uni, 1979), G.A. Wallin avait ceci à dire de la tribu connue sous le nom Hutaym :

    Ils sont méprisés et maltraités par leurs voisins Bedawy, à qui ils sont obligés de payer un lourd impôt fraternel (khawe) sans en être libérés par d'autres contributions de toutes sortes. J'ai souvent vu avec quelle arrogance les Bedawies poussaient leurs chevaux et chameaux à travers les champs encore non tondus, permettant aux animaux de se nourrir sur le blé sans aucune vérification ... ils [les Hutaym] se soumettent silencieusement à leur tyrannie.

    Lorsqu’ils sont dans leurs tentes, on les voit généralement faire quelques travaux manuels, comme la réparation de leurs armes ou fabriquer des ustensiles et des meubles ... Ils ont également montré un fort sentiment religieux ... dans leurs traits du visage également une autre origine doit être tracée, et leur type est le plus évidemment syrien, mais souvent avec un groupe très important juif. Je les considère comme un reste maigre de certains des vieux aborigènes juifs ou nabatéens de la terre, ... (p. 133)

 

Le commentaire de Wallin au sujet de la façon des Bedawi (Bédouins) de conduire le bétail dans les cultures de leurs voisins n'est pas sans rappeler les Madianites qui ont fait la même chose aux Israélites quand ils ont reçu la maîtrise sur Israël (Juges 6:3-6).

 

L’utilisation de Burton du terme Gitan à plusieurs reprises peut être la clé de l'identité d'un groupe relativement restreint des descendants actuels de Madian. En fait, il peut y avoir un dossier solide pour l'inclusion de ces personnes avec les autres fils connus de Ketura.

 

L’article de Wikipédia (abrégé) sur les Gitans ou Roms contient un certain nombre de faits intéressants.

 

Les Roms (singulier Rom ; parfois Rroma, Rrom) ou Romanies, parfois appelés "peuple rom" au Royaume-Uni, souvent désignés comme les tsiganes ou tziganes, sont un groupe ethnique diversifié qui vit principalement dans le Sud et l’Est de Europe, l'Asie occidentale, l'Amérique latine, les États-Unis et le Moyen-Orient. Ils sont soupçonnés d'avoir pris naissance dans les régions du Pendjab et du Rajasthan du sous-continent indien. Ils ont commencé leur migration vers l'Europe et l'Afrique du Nord par l'intermédiaire du plateau iranien vers 1050. La plupart des Roms parlent un dialecte parmi plusieurs dialectes de Romani, une langue indo-aryenne.

 

La plupart des Roms se référent à eux-mêmes comme Rom. Le mot signifie " mari", tandis que Romni signifie " femme". … L'origine du mot Rom ... est proposée comme le mot sanscrit ram ... ou rama ... qui signifie "mari".

 

Dans le monde, on estime qu'il y a entre 8 à 10.000.000 Roms. La plus grande population de Roms se trouve sur la péninsule des Balkans, mais un nombre important vit aussi dans les Amériques, l'ex-Union soviétique, l'Europe occidentale, le Moyen-Orient, et l’Afrique du Nord. Les Roms reconnaissent des divisions entre eux basées en partie sur les différences territoriales, culturelles et dialectales. Certaines autorités reconnaissent cinq groupes principaux :

Les Kalderash sont les plus nombreux, traditionnellement chaudronniers, des Balkans, dont beaucoup ont migré vers l'Europe centrale et en Amérique du Nord ;

Les Gitanos (également appelés Kalés), principalement dans la Péninsule Ibérique, l'Afrique du Nord, et le Sud de la France ; associés au divertissement ;

Les Sintis principalement en Alsace et dans d'autres régions de la France et l'Allemagne ; souvent forains et gens du cirque (D'autres experts, et des Sintis eux-mêmes, insistent sur le fait que les Sintis ne sont pas un sous-groupe des Roms, mais plutôt un groupe ethnique distinct qui avait aussi des origines indiennes et un historique de nomadisme) ;

Les Romanichels (Rom'nies), principalement en Grande-Bretagne et en Amérique du Nord, et

Les Erlides (également connu sous le nom Yerlii ou Arli ) établis dans le Sud-est de l'Europe et la Turquie.

 

Les chercheurs contemporains ont suggéré que l'une des premières références écrites aux Roms, sous le terme "Atsinganoi", (en grec), date de l'époque byzantine au cours d'une période de famine au 9ème siècle. En l'an 800 A.D., Saint Athanasia a donné la nourriture à des "étrangers appelés les Atsinganoi" près de la Thrace. Plus tard, en 803 A.D., Théophane le Confesseur écrit que l'Empereur Nicéphore I eut l'aide des "Atsinganoi" pour réprimer une émeute avec leur "connaissance de la magie".

 

"Atsingani" a été utilisé pour se référer aux diseurs de bonne aventure itinérants, ventriloques et sorciers qui ont visité l'Empereur Constantin IX en l'an 1054. ... En 1322, un moine franciscain du nom de Simon Simeonis décrit des gens qui ressemblent à ces "atsinganoi" vivant en Crète, et en 1350 Ludolphe de Sudheim a mentionné un peuple similaire avec une langue unique qu'il a appelée Mandapolos, un mot qui, selon des théories, est peut-être dérivé du mot grec mantes (qui signifie prophète ou diseur de bonne aventure).

 

Autour de 1360, un fief indépendant Romani (appelé le Feudum Acinganorum) a été créé à Corfou et est devenu "une communauté établie et une partie importante et constante de l'économie." [32] ... Au 14ème siècle, les Roms avaient atteint les Balkans ; en 1424, l'Allemagne, et au 16ème siècle, l'Écosse et la Suède. Certains Roms ont migré de la Perse à travers l'Afrique du Nord, atteignant l'Europe via l'Espagne au 15ème siècle. Les deux courants se sont réunis en France. ...

 

Les Roms ont été réduits en esclavage pendant cinq siècles en Roumanie jusqu'à l'abolition en 1864. Ailleurs en Europe, ils ont fait l'objet d'un nettoyage ethnique, d'enlèvement de leurs enfants, et d’un travail forcé. Au cours de la Seconde Guerre Mondiale, les Nazis ont assassiné 200.000 à 800.000 Roms dans une tentative de génocide connu sous le nom des Porajmos. Comme les Juifs, ils ont été destinés à l'extermination et condamnés aux travaux forcés et l'emprisonnement dans des camps de concentration.

 

Les données génétiques appuient fermement les preuves linguistiques que les Roms sont originaires du sous-continent indien. Les études de la génétique des bulgares, baltiques et Vlax Roma indiquent qu'environ 50% des haplotypes observés appartiennent à l’haplogroupe Y-chromosomique H. Des études similaires de la même population avec l'ADN mitochondrial démontrent que 50% appartiennent à l’haplogroupe femelle mitochondrial M. Les deux sont très répandus en Asie du Sud.

 

Hg. H est un dérivé de F, qui est la mutation primaire pour tous les Sémites et Japhetites. 36% des Roms sont soit des Sémites Hg. I soit J2. H est connecté en tant que division antérieure de F.

 

Cette preuve génétique indique que près de la moitié du patrimoine génétique de ces Roms étudiés est similaire à celle des populations environnantes européennes. Plus précisément, les haplogroupes communs du chromosome Y (c.-à-d. lignée par les hommes) sont les haplogroupes H (50%), I (22%) et J2 (14%), et R1b (7%). Les haplogroupes communs mitochondriaux (c.-à-d. lignée par les femmes) sont H (35%), M (26%), U3 (10%), X (7%), autres (20%). Alors que l’haplogroupe mâle H et l’haplogroupe femelle M sont rares dans les populations européennes non-Roms, le reste se trouve dans toute l'Europe. Cependant, les haplogroupes femelles U2i et U7 sont pratiquement absentes des femmes Roms, mais sont présents en Asie du Sud (11% -35% environ).

 

En revanche, les Sinti Roma mâles en Asie centrale ont H (20%), J2 (20%) et une fréquence élevée de R2 (50%) qui se trouve fréquemment dans le Bengale occidental et parmi les Cinghalais du Sri Lanka. Le marqueur M217, qui représente environ 1,6% des hommes Roma, se trouve également dans le Bengale occidental (Kivisild (2003) et al). L’haplogroupe L est observé chez environ 10% des hommes indiens, mais est absent des Roma (quoique Gresham et al. ne semblent pas tester pour cela), et aussi des Sinti du Bengale occidental et d'Asie centrale (Kivisild (2003) et al). Toutefois, une recherche de la base de données Yhrd montre que certaines populations roms en Europe ont des pourcentages considérables d’haplogroupe R1a1 mâle. Yhrd donne quelques correspondances avec les populations sud-asiatiques, mais un grand nombre de correspondances sur l'haplogroupe H avec les Londoniens britanniques d'Asie, une population qui a une grande proportion de groupes bengalis et sri-lankais.

 

Une étude publiée dans Nature associe les Roms avec les Cinghalais, et doit être considérée à partir de ce profil génétique des Roms. Les Cinghalais sont pour la plupart descendants de l'Est et du Sud des communautés indiennes."

 

Ces données et les informations ci-dessus indiquent que les Cinghalais sri-lankais pourraient bien être Sémites de la même base antérieure que les Roms et peuvent être le groupe d’Ophir des fils de Sem avec les Roms étant un autre des frères d'Ophir des Hébreux Jokthan avec certains Bengalis également liés.

 

Toutes ces études génétiques indiquent une origine Sud-est indienne de la population masculine des Roms. L’haplogroupe R1a1 se produit autour de 35-45% dans le nord-ouest du sous-continent indien, mais seulement 10-15% dans le sud-est. Par ailleurs, les haplogroupes Y H, R2 et J2 augmentent en fréquence vers le sud-est. R2 se produit autour de 20-40% dans le Bengale occidental et l'Andhra Pradesh (Bamshad et al. 2001, Kivisild et al. 2003, Sengupta et al. 2006, Sahoo et al. 2006). H et J2 se produisent 20-30% dans le Sud et l’Est de l'Inde.

 

La recherche de Luba Kalaydjieva a montré que le groupe original est apparu en Inde il y a quelques 32-40 générations de cela et était petit, probablement moins de 1000 personnes.

(Réf. : Origins and Divergence of the Roma (Gypsies), David Gresham, Bharti Morar, Peter A. Underhill, et al, Am J Hum (2001); The Eurasian Heartland: A continental perspective on Y-chromosome diversity, Wells et al.) (Récupéré de http://en.wikipedia.org/wiki/Roma_people)

 

Le R2 est un groupe japhethite qui est aryen et apparenté aux Celtes et aux Slaves. Ces deux groupes sont les descendants de l’Haplogroupe R de base, qui se trouve parmi les Dravidiens et une grande partie des Aborigènes d'Australie. Les vagues ultérieures des Aborigènes australiens étaient donc des Aryens liés aux Dravidiens, qui se sont entremêlés avec les premiers habitants de base C de l'Australie et peut-être même aussi tard que le premier millénaire AEC de l'indianisation de l'Asie du Sud Est. L'invasion aryenne de l'Inde a eu lieu en 1000 AEC et la subdivision R de base est une mutation ultérieure du système d'ADN-Y dérivé de P. trouvée au Cameroun (Afrique), en Australie et en Inde, tout en étant très légèrement étendue à travers le Moyen-Orient. Ainsi, un pourcentage significatif des Aborigènes est proto-Celtes/Slaves ou Aryens des fils de Japhet. Nous allons examiner de plus près les temps ci-dessous.

 

Le dictionnaire The Concise Oxford Dictionary, sous la rubrique gypsy (gitan), dit aussi que les Roms étaient "d'origine hindoue à la peau et les cheveux foncés, et parlant une langue (le romani) liée au hindi". Il donne l'origine du terme en tant que : "gipcyan, gipsen antérieur de l'égyptien, de l'origine supposée des gitans quand ils sont apparus en Angleterre au début du 16ème siècle."

 

L’ADN-Y gitan peut ressembler à ceci :

H   M69
•       H*   -
•       H1   M52
•      •       H1*   -
•      •       H1a   M82
•      •       •       H1a*   -
•      •       •       H1a1   M36, M197
•      •       •       H1a2   M97
•      •       •       H1a3   M39, M138
•      •       H1b   M370
•       H2   Apt

L’Haplogroupe H de l’ADN-Y : La mutation fondatrice de l'Haplogroupe H, M69, est survenue chez un homme de l’Haplogroupe F, probablement dans le sous-continent indien. Bien sûr, les évolutionnistes affirment que le fondateur de l'Haplogroupe H a probablement vécu il y a environ 30000-40000 ans. Cet Haplogroupe n'a pas encore été étudié d'une manière étendue. Aujourd'hui, presque tous les membres de l'Haplogroupe H vivent dans la région du sous-continent indien. Le peuple Rom (aussi connu comme Gitan), qui, apparemment, est originaire de l'Inde, est la principale source de l'Haplogroupe H en Europe occidentale.

 

Ainsi, le Haplogroupe H de l’ADN-Y a été développé à partir de F sur le sous-continent indien (comme l’a été L) et la principale source de H en Europe vient des Gitans et des immigrants indiens ultérieurs. Les Haplogroupes G, H, I et J sont supposés être d’origine sémitique et G, H, I se trouvent dans les Assyriens avec I et J étant trouvés dans les Assyriens, Arpacschadites ou Hébreux, Arabes de Ketura et Arabes Ismaélites et les populations juives, respectivement. I et J sont maintenant des dérivations connues du groupe unique IJ. Alors que nous pouvons raisonnablement bien démontrer que les Gitans sont d'origine sémitique qui est venue en passant par l'Inde, nous ne pouvons pas démontrer leur origine dans les fils de Ketura. La langue des Romani a été apparemment développée en Europe après avoir quitté l'Inde. Le sous-groupe des Vlax Rom est probablement dérivé d'un ancêtre il n’y a pas plus de 400-500 ans de cela en Europe.

 

L’Haplogroupe F

L’Haplogroupe F est issu de la division entre le Yap M145, la division M203 pour D et E et la division RPS4Y 711 M216 pour le groupe C. C'est un petit groupe et il agit parfois comme un fourre-tout parce que les chercheurs n'ont pas fait assez de tests pour déterminer le groupe correctement. Il y a des petits groupes F en Géorgie/Arménie, en Perse, en Ouzbékistan, parmi les Tartares Kazan et au Kazakhstan. La conclusion est que la racine de base de F est presque disparue, mais les fils prolifiques ont survécu et ont prospéré, produisant ainsi les groupes nationaux principaux et les mutations qui ont découlé de cette branche.

 

Cette branche détermine tous les autres Haplogroupes de F à R.

 

Le F de base est P14, M89, M213.

 

En termes bibliques, tant Sem que Japhet ont passé ce Haplogroupe central à toute leur progéniture. Peut-être Cham l'a aussi passé à un de ses fils. Les diagrammes montreraient les fils de Cham comme étant très divergents.  

Les groupes de l’ADN-Y

 

Tous les autres groupes de l’ADN-Y à partir de G à R2 sont dérivés d'un Haplogroupe central F. Ce groupe F est au cœur de lignées connues à la fois de Sem et de Japhet. Nous allons commencer par la Lignée F, qui est P14, M89, M213. Cette ligne est la ligne de base pour G, H, I, J et K.

 

Nous savons que les lignées de peuples sémitiques connus sont G, I et J. Il y a aussi quelques lignées des lignées E3B africaines ou chamitiques, avec quelques-unes R1a et R1b. Ces lignées avec G s'étendent aussi à la Turquie, la Géorgie/Arménie et l'Italie.

 

La sagesse conventionnelle indique les Arabes du Moyen-Orient comme l'Haplogroupe J, et le sacerdoce juif d’Aaron, qui a une lignée claire identifiée à Sem, est à J2. Cette division d’Haplogroupe identifie également le Clan Buba de la tribu des Lemba du Zimbabwe en tant que sacrificateurs d'Aaron et ils ont été séparés du reste de Juda/Lévi pendant peut-être 1900-2,500 ans. Ainsi, la division J2 est au moins aussi ancienne que cette séparation.

 

Les Haplogroupes K, L, M, N, O, P, Q et R de P29 semblent être des tribus japhethites. Dieu a dit qu'Il bénirait Japhet, à qui il a été dit que Dieu l’élargirait et qu’il habiterait dans les tentes de Sem. Ainsi nous nous attendrions à trouver un mélange de Japhet et Sem dans les mêmes groupes nationaux. Ainsi les groupements d’Hgs. I et R1b et R1a satisfont à ces critères.

 

L'argument pourrait être soulevé que les Haplogroupes de Sem et Japhet sont tous les deux F et que tous leurs fils sont de simples variations de leur part, sans distinction, et donc G à J sont des deux groupes avec K formant la division suivante et qui n'apparaît pas dans le plus connu J sémitique. Ainsi K doit inclure Japhet en entier, mais on pourrait alors faire valoir que G à I sont ouverts aux deux. Ces arguments ne semblent pas résister à un examen sur une base démographique simple.

 

La bénédiction de Japhet place Japhet dans les tentes de Sem, et donc la prophétie se réalise. Les bénédictions de Sem reviennent à Japhet, même si Japhet est plus grand en termes de pourcentage dans chaque nation.

 

Ce qui est certain, c'est que dans la mesure même des Haplogroupes I et R1b et aussi R1a en Europe, il est pratiquement impossible pour toute personne en Europe de ne pas être un descendant d'Abraham, d'Isaac et de Jacob, que ce soit à travers leurs lignées maternelles ou paternelles. Ainsi l'alliance hittite et parthe avec Israël en a fait un seul peuple, réparti sur une vaste zone avec des entités linguistiques différentes. Abraham est en effet devenu le père de nombreuses nations. 

Le puzzle de l’ADNmt

 

Comme nous l'avons noté dans l’étude L'Origine Génétique des Nations (No. 265), il "y a 26 Haplogroupes ADNmt indiquant 26 lignées ADNmt femelles. Quelque sept Hgs. originaux ou "Ève" femelles sont posés pour l'Europe. Toutefois, lorsque l'on examine l'arbre de l'ADNmt, on trouve quelques dérivés intéressants du groupe. Les soi-disant Super-groupes sont en réalité seulement dans trois groupes de base. En d'autres termes, ils sont venus de trois principales lignées par les femmes. C'est ce que nous nous attendrions à trouver si nous supposons qu'il n'y avait que trois femmes qui ont procréé depuis l'Arche, à savoir les épouses de Sem, Cham et Japhet. Ces Haplogroupes sont tous des descendants d'un seul Super-groupe féminin, à savoir l'Haplogroupe L. Donc, en réalité, toutes les femmes sont les descendantes d'une lignée féminine Hg. L. Cela est super L. Cette lignée s’est alors divisée en L1, puis L2 et L3. La ligne L3 a divergé et de L3 sont venues les autres mutations de l'ADNmt. Ainsi, toutes les femmes provenaient d'une Ève dont la lignée ADNmt était L.

 

Les groupes L L1, L2 et L3 sont tous situés en Afrique et sont les principaux groupes presque exclusivement en Afrique sub-saharienne. Seulement de l'Éthiopie Nord nous obtenons une grande diversité de comptes-rendus ADNmt. C'est la raison fondamentale pour laquelle les évolutionnistes affirment que nous sommes tous venus d'Afrique. La mise en place des groupes d'ADN peut être vue dans l’ouvrage de J.D. McDonald qui les a regroupés par cartes de Haplogroupes Y et ADNmt disponibles au

http://www.scs.uiuc.edu/~mcdonald/WorldHaplogroupsMaps.pdf.

 

Les Super-groupes M et N devaient ensuite diverger ou muter. D'un point de vue biblique, nous pouvons débattre facilement que L a été formé avec Ève et les autres groupes étaient des divisions pré-Déluge qui sont venus sur l'Arche. Ainsi, nous pourrions soutenir à juste titre que L, M et N sont venus sur l'Arche dans le récit biblique accepté. Il est également possible que la subdivision Super-groupe R puisse être venue sur l'Arche, en fonction du nombre de femmes. Tous les haplogroupes ADNmt sont des subdivisions de L, alors M et N, puis R, qui lui-même est une mutation de l’Hg. N. Ainsi, le seul argument entre le récit biblique et l'ADN de la science moderne est la supposition que les modèles mathématiques exigent une période beaucoup plus longue pour muter que la chronologie de la Bible. Cette hypothèse est basée sur la prémisse que l'ADNmt ne force pas la mutation du Génome Humain et cette supposition est maintenant révélée comme étant fausse.

 

Ainsi, à partir de l’Hg. L d'origine nous obtenons Hg. M et Hg. N. Ces deux groupes sont indépendants des mutations directes de l’Hg. L.

 

Donc on peut supposer qu’Ève a produit la ligne L et les trois femmes de Sem, Cham et Japhet sont au moins les trois groupes L, M et N. Il peut y avoir eu de nouvelles divisions, étant donné le fait que Noé a peut-être eu des filles non mentionnées, et leur lignée de l'ADNmt peut avoir été L, ou M ou N. Elle a peut-être même été R, si nous supposons que la lignée L entière est entrée par la femme de Cham, puisque la lignée L est presque confinée aux tribus sub-sahariennes. Nous devons également tenir compte du fait qu’Ève avait la peau sombre et le fait qu’Adam signifie “celui qui était rouge”.

 

Les épouses de Sem et Japhet étaient des subdivisions de L, peut-être M et N ou peut-être aussi R.

 

Les deux groupes M et N ont formé des sous-groupes suivants :

M a produit trois subdivisions :

Sous-groupe M, y compris ;

C et Z, qui se sont séparés l’un de l'autre, et D et G ;

Subdivision E ; et

Subdivision Q

 

On pourrait donc aussi en déduire que les femmes des fils de Noé ont été prises à partir de l’unique lignée familiale préservant la pureté dans les générations dans la ligne féminine aussi. La scission L2 et L3 peut provenir de la structure familiale d'avant le Déluge. Les filles de Noé et les femmes des fils auraient pu porter les trois subdivisions L et les sous-groupes de base de M, N et peut-être R. Tous les groupes suivants à partir de R sont des sous-groupes de R.

 

Il est par conséquent possible que les femmes de l'Arche, même si il n'y avait que les filles de Noé et les épouses de Sem, Cham et Japhet, auraient pu facilement contenir la base de la diversité moderne de l’ADNmt. Nous ne serions pas surpris de trouver une telle diversité dans une famille de fils mariés, même aujourd'hui. En Palestine, en Égypte et au sud du Pakistan, il est courant aujourd'hui de trouver ces groupes.”

 

Nous traiterons de la diversité de l’ADNmt féminin des nations sémitiques connues dans une étude ultérieure. Elles impliquent des croisements entre les nations, et nous pouvons identifier ces lignées ailleurs.

 

Dans l’étude L'Origine Génétique des Nations (No. 265) nous avons conclu qu'“il n'y a donc rien dans les variations de l'ADNmt et les Haplogroupes pour empêcher l'histoire de la Bible et le récit de la Genèse d’être accommodés par, ou accommodant, les démarches scientifiques que nous trouvons ici.

 

Les Haplogroupes L, M, N et peut-être R de l’ADNmt étaient présents dans les femmes sur l'Arche. Les mutations se sont produites alors que chaque groupe s’est déplacé hors du Moyen-Orient et s’est croisé avec des tribus et des familles en déplacement au fil du temps.”

L’Haplogroupe Sémitique J

 

L’article de Wikipédia sur l’Haplogroupe Sémitique J a identifié l’Haplogroupe comme venant à l'origine de l’Haplogroupe combiné IJ. Le groupe IJ est défini par S2 et S22 dans la chaîne de l’ADN-Y.

 

La signification est que la science commence à soutenir et à accepter que I et J étaient autrefois le même groupe et que tous les gens de l’Hg. I sont venus de la même ascendance que les Juifs et les Arabes qui possèdent le système J. Ainsi nous avons une acceptation claire en termes bibliques que le récit de la Bible pour que les peuples hébreux soient venus du même ancêtre, Arpacschad, est correct.

 

Ce que nous ne savons pas vraiment, c'est si le groupe IJ s’est développé dans l’un des autres fils de Sem.

 

L’Haplogroupe J a été précédemment connu sous le nom HG9 ou Eu9/Eu10. Il est défini par le marqueur génétique 12f2.1, ou le marqueur équivalent M304.

 

Alors que la science soutient ces séquences étendues de temps de l'évolution, elle est toujours d’accord qu'elles ont surgi du Proche-Orient. L’Haplogroupe IJ est à son tour dérivé de l'Haplogroupe F. Cet Haplogroupe est l'Haplogroupe clé pour tous les peuples sémitiques et japethites.

 

Les principaux sous-groupes actuels de J sont J1 et J2, et entre eux compte la quasi-totalité de la population de l'Haplogroupe. La structure de temps de la Bible ne permet pas une origine plus tôt que 2200 AEC. Le Haplotype modal Cohen (CMH) pour les fils d'Aaron tombe en J1 et J2.

 

La majeure partie de CMH est observée dans J1 (53,0%) et J2 (43,2%) avec une petite portion qui ne relève pas de l’Haplogroupe J (3,8%). Ainsi, les divisions J1 J2 et autres doivent avoir eu lieu après la scission du sacerdoce d'Aaron en 722 AEC ou c’est une mutation indépendante qui n’identifie pas exclusivement le sacerdoce entier.

 

Wikipédia affirme que “même si vous pouvez avoir le CMH dans soit J1 soit J2, c'est la signature génétique dans J1 qui est considérée comme la signature juive sacerdotale.”

 

L’Haplogroupe J2 est défini par le marqueur M172, et l’Haplogroupe J1, défini par le marqueur M267.

 

L'article de Wikipédia sur l’Haplogroupe J1 (ADN-Y) dit :

L’haplogroupe J1 est notable puisque cet haplogroupe montre les plus hautes fréquences au Moyen-Orient, en Afrique du Nord et en Éthiopie [Thomas et al étude 1999]. J1 a été propagé par deux épisodes migratoires temporellement distinctes, dont la plus récente est probablement associée à la diffusion du peuple arabe. L’haplogroupe J1 est plus fréquent dans les Arabes palestiniens (38,4%) [Semino et al.] et les Bédouins arabes (62% et 82% dans les Bédouins du désert du Néguev). Toujours dans les pays arabophones comme : Algérie (35%), la Syrie (30%), le sud de l'Irak Levant (33%), la péninsule du Sinaï, et la péninsule arabique s'effondrant subitement aux frontières des pays arabes avec les pays non arabes (Turquie et l'Iran). Il est entré en Éthiopie dans le Néolithique avec la Révolution Néolithique et la propagation de l'agriculture, où il se trouve principalement parmi les locuteurs sémitiques (par exemple Amhara 33,3%, mais Oromo 3,8%). Il s'est répandu plus tard en Afrique du Nord dans les temps historiques (tels que définis par le motif YCAIIa22-YCAIIb22 ; Algériens 35,0%, Tunisiens 30,1%), où il est devenu quelque chose comme un marqueur de l'expansion arabe dans la période du Haut Moyen Âge (Semino et al. 2004). Les chercheurs croient que le marqueur DYS388=17 (tests d’ADN-Y pour STR – Short Tandem Repeater (Répéteur en Tandem Court)) est lié à l'expansion ultérieure de tribus arabes dans le Levant sud et le nord de l'Afrique (Di Giacomo et al. 2004). L’Haplogroupe J1 se retrouve presque exclusivement chez les populations modernes du Sud-ouest de l’Asie, en Afrique du Nord, et Afrique de l'Est, essentiellement délimitant la région connue sous le nom Moyen-Orient et associée avec des locuteurs de langues sémitiques. La distribution de J1 à l'extérieur du Moyen-Orient est associée [avec] les Arabes et Phéniciens à travers le commerce et la conquête comme la Sicile, le sud de l'Italie, l'Espagne, l'Azerbaïdjan, la Turquie, le Pakistan, et avec les Juifs qui ont des origines historiques au Moyen-Orient et parlent (ou ont historiquement parlé) une langue sémitique, mais en général l’Haplogroupe J2 est plus de deux fois plus fréquent chez les Juifs. Dans les populations juives dans l'ensemble, J1 constitue 14,6% des résultats ashkénazes et 11,9% des résultats séfarades (Semino et al. 2004).

 

Wikipédia dit concernant l’Haplogroupe J2 (ADN-Y)

L’haplogroupe J2 est présent principalement en Europe, mais on le trouve surtout dans le nord du Levant (Kurdistan, l'Arménie), en Anatolie : les Kurdes musulmans (28,4%), les Turcs centraux (27,9%), les Géorgiens (26,7%), les Irakiens (25,2%), les Libanais (25%), les Juifs ashkénazes (23,2%) et les Juifs séfarades (28,6%). J2 ne se trouve pas dans les populations parlant des langues sémitiques de l'Afrique (comme Amhari et Tigrinia en Éthiopie) (Semino et al. 2004). Toutefois, J2 a été trouvé pour englober plusieurs sous-Haplogroupes sans rapport (22 sous-groupes avec 12 sous-groupes qui ont de hautes fréquences) qui ont pris naissance dans différentes régions : les Italiens, les Balkans, les Égéens, les Balkans, Anatoliens (les Kurdes et la Turquie), du Caucase (Georgia.) et enfin Somaliens (voir réf. : Semino et al. 2004). Cela a été considéré comme les marqueurs génétiques d'agriculteurs néolithiques anatoliens. Il est également très fréquent dans les Balkans (Grecs 20,6%, Albanais 19,6%) et dans le sud de l'Italie (16,7 à 29,1%). Sa fréquence diminue rapidement dans le bassin des Carpates (Croates 6,2%, Hongrois 2,0%, Ukrainiens 7,3%). La présence significative de J2 (J2b2+J2a) en Inde (18,6% dans les castes supérieures dravidiennes, 14% dans les castes aryennes supérieures, 2% dans les tribus ; Sengupta et al. 2006) doit être d'une date assez récente, parce que “le J2 indien n'est pas accompagné par son ‘fidèle compagnon de route’ E3B1 qui a pénétré au Proche-Orient de l’Afrique du Nord après la fin de l'Ère Glaciaire et est étroitement lié à la propagation des deux sous-branches de J depuis le néolithique.”

(cf. article de Wikipédia Haplogroupe J)

 

L'importance de l'Haplotype modal Cohen à la fois dans J1 et J2 indique que la division et le développement de ces Haplogroupes sont un résultat de mutation après la propagation du sacerdoce d'Aaron, qui n'est pas intervenue plus tôt que 1458 AEC et peut-être plus tard en 722 AEC. Une grande portion de cela semble être parmi les Arabes aussi.

 

L'Haplotype mute donc plus rapidement que ce qui était pensé et les modèles sont faux.

 

La présence de J2 en Inde sans le voyageur E3B1 indique que l'Haplotype J2 s’est développé en Inde à partir des Hébreux, qui ne s’étaient pas croisés avec les Cananéens ou les Égyptiens soit dans la Multitude Mélangée soit dans l'occupation de Canaan. Ainsi, la migration de ces personnes doit avoir eu lieu avec les premiers Hébreux (peut-être Jokthan, ou même plus tôt) qui se sont déplacés de l'Assyrie probablement avec les Assyriens et les Cushites et certains Hg. RxR1 Japhetites à Harappa et Mohenjo Daro, dans l'Indus peut-être même dès l'occupation au 18ème siècle AEC (cf. Le Mysticisme Chapitre 1 Diffusion des Mystères Babyloniens (No. B7_1).

 

Les Sémites se sont déplacés en Inde du Sud, au Bengale et au Sri Lanka. Les Cinghalais du Sri Lanka ont également des lignées japhetites R2, qui sont la mutation indienne de RxR1. Comme nous l'avons vu, les Roms ont des mélanges similaires d’Haplogroupes.

 

Les Cushites et Japhetites sont également entrés en Inde du Sud et se sont déplacés en Asie du Sud.

 

Le peuple K a muté de F et une section importante a formé les Négritos et Mélanésiens.

 

La division suivante de la subdivision japhetite F et le RxR1 s'étaient séparés d'eux en P au Moyen-Orient.

 

L’Hg. P a muté en l’Hg. RxR1 à partir duquel tous les Celtes et les Slaves sont les descendants.

 

RxR1 est resté en Inde formant les Dravidiens et un autre groupe de base a déménagé avec la majorité Hg. C de base et a formé la base de la population autochtone australienne ca. 1700 AEC. Ils semblent être venus en huit vagues, peut-être pas mélangée à l'origine. Une communauté est apparemment une arrivée tardive d’Hg. O, probablement des Indo-Malais ou Chinois.

 

Les Cushites et les autres Chamitiques se sont également déplacés du Nord-est et ont formé les Mongols et la population de base de ce qui devint les Maoris et les Amérindiens C3. Le groupe chamitique a également constitué la mutation Hg. D à partir de laquelle un grand nombre des Japonais et des Tibétains sont les descendants.

 

K à M9 se sont également divisés en un seul groupe M214 qui a formé la branche des fils japhetites des Huns et des Finlandais sous l’Haplogroupe N, avec les Chinois et les Malais et certains Polynésiens et Philippins sous l’Haplogroupe O.

 

Les populations fondamentales de Papouasie/Nouvelle Guinée ont conservé le K d'origine de même que certains commerçants phéniciens à K2.

 

Aucun Sémite ne s’est déplacé à l'Australasie.

 

La Tasmanie a été habitée à l'origine par les Négritos K comme l’a été la Nouvelle-Zélande avec les Maorii ou Moriori après un établissement précédent et finalement ils ont été chassés par les Maoris HG C.

 

L’information spécifique de Wikipédia sur la Base J est la suivante :

 

J*(xJ1,J2)

Il y a aussi quelques chromosomes Y de l’Haplogroupe J qui n'appartiennent ni à J1 ni à J2, et il est dit qu’ils sont dans le Haplogroupe ou paragroupe J* (xJ1,J2), cependant, ils sont extrêmement rares. Cela signifie que l'Haplogroupe J* comprend tous les J sauf J1 et J2 

 

Spécification technique de mutation

Les détails techniques de M304 sont les suivants :

Changement de nucléotides : A à C

Position (paires de bases) : 421

Taille totale (paires de bases) : 527

Marche avant 5 '→ 3' : caaagtgctgggattacagg

Inverser 5 '→ 3' : cttctagcttcatctgcattgt

 

Les Haplogroupes sémitiques et leurs sous-clades seront reproduits dans l’Appendice d’une autre étude.

 

Les tableaux des lignées des fils de Sem seront reproduits dans l’étude Les Fils de Sem Partie VII : Graphiques pour P212A-212F (No. 212G).

q